mycBioID-pBabePuro-myc-BirA*NRASG12V
(Plasmid #122212)

• Purpose: Stably expresses myc-BirA* fused to NRASG12V in mammalian cells
• Depositing Lab: Christopher Counter
• Publication: Adhikari et al Nat Commun. 2018 Sep 7;9(1):3646. doi: 10.1038/s41467-018-05692-6.

Backbone

• Vector backbone: mycBioID-pBABE-puro
• Backbone size w/o insert (bp): 6213
• Total vector size (bp): 6780
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NRASG12V
• Alt name: NRAS
• Species: H. sapiens (human)
• Insert Size (bp): 567
• Mutation: changed G12 to V
• GenBank ID: 4893
• Entrez Gene: NRAS (a.k.a. ALPS4, CMNS, KRAS, N-ras, NCMS, NRAS1, NS6)
• Tag / Fusion Protein:
  • myc-BirA* (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTTTATCCAGCCCTCAC
• 3′ sequencing primer: ACCCTAACTGACACACATTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry