mycBioID-pBabePuro-myc-BirA*KRASG12V
(Plasmid #122211)

• Purpose: Stably expresses myc-BirA* fused to KRASG12V in mammalian cells
• Depositing Lab: Christopher Counter
• Publication: Adhikari et al Nat Commun. 2018 Sep 7;9(1):3646. doi: 10.1038/s41467-018-05692-6.

Backbone

• Vector backbone: mycBioID-pBABE-puro
• Backbone size w/o insert (bp): 6213
• Total vector size (bp): 6777
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRASG12V
• Alt name: KRAS4B
• Species: H. sapiens (human)
• Insert Size (bp): 564
• Mutation: changed G12 to V
• GenBank ID: NM_004985
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Tag / Fusion Protein:
  • myc-BirA* (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTTTATCCAGCCCTCAC
• 3′ sequencing primer: ACCCTAACTGACACACATTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry