pLenti spCas9 T2A mNeonGreen P2A puro
(Plasmid #122183)

• Purpose: The plasmid codes for a Flag-spCas9 protein, a mNeonGreen fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.
• Depositing Lab: Raphael Gaudin
• Publication: Lenti spCas9 T2A iRFP670 P2A puro (unpublished)

Backbone

• Vector backbone: pLenti
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: spCas9
• Alt name: human-codon-optimized spCas9
• Insert Size (bp): 4101
• Entrez Gene: NEWENTRY

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: GACAAGAAGTACAGCATCGGCCT
• 3′ sequencing primer: GTCGCCTCCCAGCTGAGACA

Gene/Insert 2

• Gene/Insert name: mNeonGreen
• Alt name: mNG
• Insert Size (bp): 705
• GenBank ID: LC279210.1
• Tag / Fusion Protein:
  • T2A (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: cagaggaagtctgctaacatgcg
• 3′ sequencing primer: caggattctcttcgacatctccg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Feng Zhang

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry