pROP-IP-FBFP
(Plasmid
#122138)
-
PurposeFMN-based fluorescent protein Reporter plasmid for B-Rex contain imperfect operator sequence (anaerobic purpose)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSC101
-
Vector typeBacterial Expression
-
Selectable markersSpectinomycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFBFP
- Promoter J23101
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccctttttctttaaaaccgaaaaga
- 3′ sequencing primer cccaatgataaccccCTAGGTCTAGGGCGGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pROP-IP-FBFP was a gift from Srivatsan Raman (Addgene plasmid # 122138 ; http://n2t.net/addgene:122138 ; RRID:Addgene_122138) -
For your References section:
A Regulatory NADH/NAD+ Redox Biosensor for Bacteria. Liu Y, Landick R, Raman S. ACS Synth Biol. 2019 Feb 15;8(2):264-273. doi: 10.1021/acssynbio.8b00485. Epub 2019 Jan 23. 10.1021/acssynbio.8b00485 PubMed 30633862