Skip to main content
Addgene

pRVdG-4FLPo
(Plasmid #122050)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 122050 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    cSPBN (pSAD)
  • Backbone manufacturer
    Karl-Klaus Conzelmann & Matthias Schnell
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLPo
  • Species
    Synthetic
  • Insert Size (bp)
    1299
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CATCAAAGTCAAGTTGATTACC
  • 3′ sequencing primer TAGACCTCTCCAGGATCG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRVdG-4FLPo was a gift from Ian Wickersham (Addgene plasmid # 122050 ; http://n2t.net/addgene:122050 ; RRID:Addgene_122050)

  • For your References section:

    "Self-inactivating" rabies viruses are susceptible to loss of their intended attenuating modification. Jin L, Matsuyama M, Sullivan HA, Zhu M, Lavin TK, Hou Y, Lea NE, Pruner MT, Dam Ferdinez ML, Wickersham IR. Proc Natl Acad Sci U S A. 2023 Feb 14;120(7):e2023481120. doi: 10.1073/pnas.2023481120. Epub 2023 Feb 6. 10.1073/pnas.2023481120 PubMed 37053554
Related items:
Commonly requested with: