Skip to main content
Addgene

SEPT11 sh2 3m shRNA
(Plasmid #122024)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122024 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    mU6pro
  • Vector type
    RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SEPT11 shRNA
  • gRNA/shRNA sequence
    UGUUCACUCGGAGCAACGUCU
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Sept11

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer unknown
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was originally cloned in Angel de Blas's lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

3-point mutations (negative control for SEPT11 sh2 shRNA targeting Septin 11 mRNA, plasmid 122023).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SEPT11 sh2 3m shRNA was a gift from Angel de Blas (Addgene plasmid # 122024 ; http://n2t.net/addgene:122024 ; RRID:Addgene_122024)

  • For your References section:

    Septin 11 is present in GABAergic synapses and plays a functional role in the cytoarchitecture of neurons and GABAergic synaptic connectivity. Li X, Serwanski DR, Miralles CP, Nagata K, De Blas AL. J Biol Chem. 2009 Jun 19;284(25):17253-65. doi: 10.1074/jbc.M109.008870. Epub 2009 Apr 20. 10.1074/jbc.M109.008870 PubMed 19380581
Related items: