SEPT11 sh2 shRNA
(Plasmid #122023)

• Purpose: Knock Down of Septin 11. It targets Septin 11 shRNA. It knocks down all known splice variants of Sept 11 mRNAs.
• Depositing Lab: Angel de Blas
• Publication: Li et al J Biol Chem. 2009 Jun 19;284(25):17253-65. doi: 10.1074/jbc.M109.008870. Epub 2009 Apr 20.

Backbone

• Vector backbone: mU6pro
• Vector type: RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SEPT11 shRNA
• gRNA/shRNA sequence: UGUUCACUCGGAUCAGCAUCU
• Species: R. norvegicus (rat)
• Entrez Gene: Sept11

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: unknown

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Insert was originally cloned in Angel de Blas's lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry