pTET-IUPi
(Plasmid #122019)

• Purpose: Expresses IUP pathway genes (ChK, IPK, idi) under inducible promoter. aTC inducible. Kan. resist.
• Depositing Lab: Gregory Stephanopoulos
• Publication: Chatzivasileiou et al Proc Natl Acad Sci U S A. 2018 Dec 24. pii: 1812935116. doi: 10.1073/pnas.1812935116.

Backbone

• Vector backbone: pTET
• Backbone manufacturer: Woolston,B.M., King,J.R., Reiter,M., Van Hove,B. and Stephanopoulos,G.
• Backbone size w/o insert (bp): 4447
• Total vector size (bp): 7794
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Choline kinase
• Alt name: ScCK
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1749
• Mutation: Codon optimized for E. coli
• GenBank ID: NC_001144.5
• Entrez Gene: CKI1 (a.k.a. YLR133W)
• Promoter: pTET

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTTACCACTCCCTATCAGTG

Gene/Insert 2

• Gene/Insert name: Isopentenyl monophosphate kinase
• Alt name: AtIPK
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 999
• Mutation: Codon optimized for E. coli
• GenBank ID: NP_173986.2
• Entrez Gene: AT1G26640 (a.k.a. AT1G26640, T24P13.2, T24P13_2)
• Promoter: pTET

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGAGGAATGCAAGAACTTCTC

Gene/Insert 3

• Gene/Insert name: isopentenyl-diphosphate Delta-isomerase
• Alt name: idi
• Species: Escherichia coli str. K-12 substr. MG1655
• Insert Size (bp): 549
• GenBank ID: NC_000913.3
• Promoter: pTET

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGGACCATCATCCGCTTCAG

Resource Information

• Supplemental Documents:
  • ptet-iup (1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry