pSEVA228-pro4IUPi
(Plasmid
#122018)
-
PurposeExpresses IUP pathway genes (ChK, IPK, idi) under constitutive promoter. Kan. resist.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122018 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSEVA228
-
Backbone manufacturerSilva-Rocha,R., Martinez-Garcia,E., Chavarria,M., Calles,B., Arce-Rodriguez,A., de las Heras,A., Paez-Espino,D.
- Backbone size w/o insert (bp) 3465
- Total vector size (bp) 7088
-
Modifications to backboneRemoved xylS gene
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCholine kinase
-
Alt nameScCK
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1749
-
MutationCodon optimized for E. coli
-
GenBank IDNC_001144.5
-
Entrez GeneCKI1 (a.k.a. YLR133W)
- Promoter pro4
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTCTATGAGTGGTTGCTGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIsopentenyl monophosphate kinase
-
Alt nameAtIPK
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)999
-
MutationCodon optimized for E. coli
-
GenBank IDNP_173986.2
-
Entrez GeneAT1G26640 (a.k.a. AT1G26640, T24P13.2, T24P13_2)
- Promoter pro4
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAATGCAAGAACTTCTCGA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameisopentenyl-diphosphate Delta-isomerase
-
Alt nameidi
-
SpeciesEscherichia coli str. K-12 substr. MG1655
-
Insert Size (bp)549
-
GenBank IDNC_000913.3
- Promoter pro4
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGACCATCATCCGCTTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEVA228-pro4IUPi was a gift from Gregory Stephanopoulos (Addgene plasmid # 122018 ; http://n2t.net/addgene:122018 ; RRID:Addgene_122018) -
For your References section:
Two-step pathway for isoprenoid synthesis. Chatzivasileiou AO, Ward V, Edgar SM, Stephanopoulos G. Proc Natl Acad Sci U S A. 2018 Dec 24. pii: 1812935116. doi: 10.1073/pnas.1812935116. 10.1073/pnas.1812935116 PubMed 30584096