pCoofy56
(Plasmid #122008)

• Purpose: (Empty Backbone) Mammalian vector for parallel SLIC cloning containing N-terminal TwinStrep and PreScission Cleavage site
• Depositing Lab: Sabine Suppmann
• Publication: Scholz et al BMC Biotechnol. 2013 Feb 14;13(1):12.

Backbone

• Vector backbone: pEF-HA
• Backbone size (bp): 5297
• Vector type: Mammalian Expression
• Tags / Fusion Proteins:
  • TwinStrep (N terminal on insert)
  • His10/none (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. C-terminal 10x His tag is flanked by stop codons. Depending on the LP2 primer used in SLIC, this C-terminal tag can be fused to the target gene. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki .

Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:

LP1 forward vector primer:SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'

LP2 - select a LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest:none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5'GAGCATCATCATCATCACCAC 3'

Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.