pCoofy51
(Plasmid #122005)

• Purpose: (Empty Backbone) Baculovirus vector for parallel SLIC cloning containing N-terminal TwinStrep with PreScission Cleavage site
• Depositing Lab: Sabine Suppmann
• Publication: Scholz et al BMC Biotechnol. 2013 Feb 14;13(1):12.

Backbone

• Vector backbone: pFastBac
• Backbone manufacturer: Thermo
• Backbone size (bp): 5334
• Vector type: Insect Expression
• Tag / Fusion Protein:
  • TwinStrep (N terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki .

Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:

LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'

LP2 reverse vector primer: SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'

Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.