pNIA-CEN-FLAG-LANS1-Set2
(Plasmid
#122002)
-
PurposeFLAG-LANS-Set2: FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122002 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNIA-CEN
- Backbone size w/o insert (bp) 8138
- Total vector size (bp) 10808
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehistone methyltransferase SET2
-
Alt nameFLAG-LANS-Set2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2670
-
MutationSet2 point mutations K538G, K539S, R549G, K550S, K551G
-
Entrez GeneSET2 (a.k.a. YJL168C, EZL1, KMT3)
- Promoter ADH1
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCATTGTTCTCGTTCCCTTTCTTCCTTG
- 3′ sequencing primer GGGACCTAGACTTCAGGTTGTCTAACTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: the Addgene ID for this plasmid is incorrectly listed in the publication as 122003. Addgene plasmid 122003 is mVenus-Flag-LANS-Set2 and Addgene plasmid 122002 is Flag-LANS-Set2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNIA-CEN-FLAG-LANS1-Set2 was a gift from Brian Kuhlman (Addgene plasmid # 122002 ; http://n2t.net/addgene:122002 ; RRID:Addgene_122002) -
For your References section:
An optogenetic switch for the Set2 methyltransferase provides evidence for transcription-dependent and -independent dynamics of H3K36 methylation. Lerner AM, Hepperla AJ, Keele GR, Meriesh HA, Yumerefendi H, Restrepo D, Zimmerman S, Bear JE, Kuhlman B, Davis IJ, Strahl BD. Genome Res. 2020 Nov;30(11):1605-1617. doi: 10.1101/gr.264283.120. Epub 2020 Oct 5. 10.1101/gr.264283.120 PubMed 33020206