Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC19-U6-AksgRNA
(Plasmid #121955)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121955 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19, BsaI site mutated
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AkCas12b single chimeric gRNA
  • Alt name
    AkC2c1 single chimeric gRNA
  • gRNA/shRNA sequence
    TCGTCTATAGGACGGCGAGGACAACGGGAAGTGCCAATGTGCTCTTTCCAAGAGCAAACACCCCGTTGGCTTCAAGATGACCGCTCGCTCAGCGATCTGACAACGGATCGCTGAGCGAGCGGTCTGAGAAGTGGCAC
  • Species
    Synthetic

Cloning Information

  • Cloning method Ligation Independent Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-U6-AksgRNA was a gift from Wei Li (Addgene plasmid # 121955 ; http://n2t.net/addgene:121955 ; RRID:Addgene_121955)
  • For your References section:

    Repurposing CRISPR-Cas12b for mammalian genome engineering. Teng F, Cui T, Feng G, Guo L, Xu K, Gao Q, Li T, Li J, Zhou Q, Li W. Cell Discov. 2018 Nov 27;4:63. doi: 10.1038/s41421-018-0069-3. eCollection 2018. 10.1038/s41421-018-0069-3 PubMed 30510770