-
PurposeCRISPR-Sirius plasmid
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121938 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepHAGE-EFS
- Backbone size w/o insert (bp) 6143
- Total vector size (bp) 7324
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCP-GFPnls
-
SpeciesSynthetic
-
Insert Size (bp)1181
- Promoter EFS
-
Tag
/ Fusion Protein
- sfGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nco I (not destroyed)
- 3′ cloning site Xba I (not destroyed)
- 5′ sequencing primer cgaaggaatagaagaagaaggtgga
- 3′ sequencing primer CCAAAGGGAGATCCGACTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-EFS-PCP-GFPnls was a gift from Thoru Pederson (Addgene plasmid # 121938 ; http://n2t.net/addgene:121938 ; RRID:Addgene_121938) -
For your References section:
CRISPR-Sirius: RNA scaffolds for signal amplification in genome imaging. Ma H, Tu LC, Naseri A, Chung YC, Grunwald D, Zhang S, Pederson T. Nat Methods. 2018 Nov;15(11):928-931. doi: 10.1038/s41592-018-0174-0. Epub 2018 Oct 30. 10.1038/s41592-018-0174-0 PubMed 30377374
Map uploaded by the depositor.
