pX330-TP53-2
(Plasmid
#121918)
-
PurposeEncodes sgRNA targeting exon 9 of TP53
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330 (Addgene #42230)
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 8487
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTP53
-
Alt namep53
-
gRNA/shRNA sequenceGGAGAGGAGCTGGTGTTGT
-
SpeciesH. sapiens (human)
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gactatcatatgcttaccgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sgRNA targeting TP53 was cloned into pX330 (Addgene #42230) using a Golden Gate Assembly reaction.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-TP53-2 was a gift from William Hahn (Addgene plasmid # 121918 ; http://n2t.net/addgene:121918 ; RRID:Addgene_121918) -
For your References section:
MDM2 and MDM4 are Therapeutic Vulnerabilities in Malignant Rhabdoid Tumors. Howard TP, Arnoff TE, Song MR, Giacomelli AO, Wang X, Hong AL, Dharia NV, Wang S, Vazquez F, Pham MT, Morgan AM, Wachter F, Bird GH, Kugener G, Oberlick EM, Rees MG, Tiv HL, Hwang JH, Walsh KH, Cook A, Krill-Burger JM, Tsherniak A, Gokhale PC, Park PJ, Stegmaier K, Walensky LD, Hahn WC, Roberts CWM. Cancer Res. 2019 Feb 12. pii: 0008-5472.CAN-18-3066. doi: 10.1158/0008-5472.CAN-18-3066. 10.1158/0008-5472.CAN-18-3066 PubMed 30755442