pIS0
(Plasmid #12178)

• Purpose: (Empty Backbone) 3'UTR segments of target genes can be inserted into this firefly luciferase reporter to test for their effects on protein production
• Depositing Lab: David Bartel
• Publication: Yekta et al Science. 2004 Apr 23. 304(5670):594-6.

Backbone

• Vector backbone: pIS0
• Backbone manufacturer: Bartel Lab
• Backbone size (bp): 5264
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: n/a
• 3′ sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)

Resource Information

• Articles Citing this Plasmid:
  • 30 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The firefly luciferase vector was modified from pGL3 Control Vector (Promega), such that a short sequence containing multiple cloning sites (5'-AGCTCTATACGCGTCTCAAGCTTACTGCTAGC GT-3') was inserted into the XbaI site immediately downstream from the stop codon.
3'UTR segments of target genes can be inserted into this vector to test for their effects on mRNA stability.