pIS2
(Plasmid #12177)

• Purpose: (Empty Backbone)
• Depositing Lab: David Bartel
• Publication: Farh et al Science. 2005 Dec 16. 310(5755):1817-21.

Backbone

• Vector backbone: pIS2
• Backbone manufacturer: David Bartel Lab
• Backbone size (bp): 3745
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)

Resource Information

• Articles Citing this Plasmid:
  • 13 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pIS2 was derived from pRL-SV40. More cloning sites have been added (the lower case is the pRL-SV40 and the caps is the new sequence that has been inserted): gaacaataattctagGAGCTCTATACCGGTCTCGATATCACTACTAGTGTtctagagcggccgct . The plasmid contains a renilla luciferase reporter driven by the SV40 early enhancer/promoter. Search Addgene's vector database for more information on pRL-SV40 from Promega.