Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLQ1371-sgITGB1-1
(Plasmid #121533)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121533 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSLQ1371
  • Total vector size (bp) 8319
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgITGB1-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Promoter mouse U6
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Antonia A. Dominguez and Lei S. Qi, Stanford University

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ1371-sgITGB1-1 was a gift from Ovijit Chaudhuri & Stanley Qi (Addgene plasmid # 121533 ; http://n2t.net/addgene:121533 ; RRID:Addgene_121533)
  • For your References section:

    Identification of cell context-dependent YAP-associated proteins reveals beta1 and beta4 integrin mediate YAP translocation independently of cell spreading. Lee JY, Dominguez AA, Nam S, Stowers RS, Qi LS, Chaudhuri O. Sci Rep. 2019 Nov 20;9(1):17188. doi: 10.1038/s41598-019-53659-4. 10.1038/s41598-019-53659-4 PubMed 31748579