pSLQ1371-sgGAL4
(Plasmid
#121514)
-
PurposesgGAL4 control. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSLQ1371
- Total vector size (bp) 8318
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgGAL4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter mouse U6
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAntonia A. Dominguez and Lei S. Qi, Stanford University
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ1371-sgGAL4 was a gift from Ovijit Chaudhuri & Stanley Qi (Addgene plasmid # 121514 ; http://n2t.net/addgene:121514 ; RRID:Addgene_121514) -
For your References section:
YAP-independent mechanotransduction drives breast cancer progression. Lee JY, Chang JK, Dominguez AA, Lee HP, Nam S, Chang J, Varma S, Qi LS, West RB, Chaudhuri O. Nat Commun. 2019 Apr 23;10(1):1848. doi: 10.1038/s41467-019-09755-0. 10.1038/s41467-019-09755-0 PubMed 31015465