pAAVsc.U6-sgGTTG.CMV/CB-Gluc
(Plasmid
#121512)
-
PurposeExpresses sgRNA targeting the intron in the MADM alleles (GT and TG).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121512 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAVsc
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgGTTG
-
gRNA/shRNA sequenceGGGTGGGAAAATAGACCAAT
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVsc.U6-sgGTTG.CMV/CB-Gluc was a gift from Guangping Gao (Addgene plasmid # 121512 ; http://n2t.net/addgene:121512 ; RRID:Addgene_121512) -
For your References section:
Cas9-mediated allelic exchange repairs compound heterozygous recessive mutations in mice. Wang D, Li J, Song CQ, Tran K, Mou H, Wu PH, Tai PWL, Mendonca CA, Ren L, Wang BY, Su Q, Gessler DJ, Zamore PD, Xue W, Gao G. Nat Biotechnol. 2018 Oct;36(9):839-842. doi: 10.1038/nbt.4219. Epub 2018 Aug 13. 10.1038/nbt.4219 PubMed 30102296