Skip to main content
Addgene

FLAG-Foxo1ADA(pCMV5)
(Plasmid #12149)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12149 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV5
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Foxo1 ADA
  • Alt name
    Fkhr ADA
  • Alt name
    Foxo1
  • Alt name
    forkhead box O1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1700
  • Mutation
    Threonine 24 to Alanine (A) and Serine 253 to Aspartate (D) and Serine 316 to Alanine (A)
  • GenBank ID
    NM_019739
  • Entrez Gene
    Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Myc (N terminal on backbone)
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid has K219R, G282R, and L619P polymorphisms. Addgene quality control sequencing also identified an E15G mutation that is not thought to affect protein function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-Foxo1ADA(pCMV5) was a gift from Domenico Accili (Addgene plasmid # 12149 ; http://n2t.net/addgene:12149 ; RRID:Addgene_12149)
  • For your References section:

    FoxO1 protects against pancreatic beta cell failure through NeuroD and MafA induction. Kitamura YI, Kitamura T, Kruse JP, Raum JC, Stein R, Gu W, Accili D. Cell Metab. 2005 Sep . 2(3):153-63. 10.1016/j.cmet.2005.08.004 PubMed 16154098