Myc-Foxo1 D256
(Plasmid #12145)

• Depositing Lab: Domenico Accili
• Publication: Nakae et al EMBO J. 2000 Mar 1. 19(5):989-96.

Backbone

• Vector backbone: pCMV5
• Backbone size w/o insert (bp): 4657
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Foxo1
• Alt name: Fkrh
• Alt name: forkhead box O1
• Species: M. musculus (mouse)
• Insert Size (bp): 2100
• Mutation: Contains a deletion truncating the protein after amino acid 255. Acts as dominant negative, lacking the transactivation domain
• GenBank ID: NM_019739
• Entrez Gene: Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CMV-F; pCEP-F
• 3′ sequencing primer: hGH-pA-R (CCAGCTTGGTTCCCAATAGA)

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid also contains a G229R mutation--author says that it will not affect the plasmid detrimentally. It also has polymorphisms K219R and L619R (the latter is not translated - it's after the truncation).