Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Myc-Foxo1 D256
(Plasmid #12145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12145 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV5
  • Backbone size w/o insert (bp) 4657
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Foxo1
  • Alt name
    Fkrh
  • Alt name
    forkhead box O1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2100
  • Mutation
    Contains a deletion truncating the protein after amino acid 255. Acts as dominant negative, lacking the transactivation domain
  • GenBank ID
    NM_019739
  • Entrez Gene
    Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMV-F; pCEP-F
  • 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid also contains a G229R mutation--author says that it will not affect the plasmid detrimentally. It also has polymorphisms K219R and L619R (the latter is not translated - it's after the truncation).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Myc-Foxo1 D256 was a gift from Domenico Accili (Addgene plasmid # 12145 ; http://n2t.net/addgene:12145 ; RRID:Addgene_12145)
  • For your References section:

    Differential regulation of gene expression by insulin and IGF-1 receptors correlates with phosphorylation of a single amino acid residue in the forkhead transcription factor FKHR. Nakae J, Barr V, Accili D. EMBO J. 2000 Mar 1. 19(5):989-96. 10.1093/emboj/19.5.989 PubMed 10698940