Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Pconst-rfp + PmutS-yfp
(Plasmid #121444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121444 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Pconst-rfp + PmutS-yfp in SC101 origin vector
  • Vector type
    Bacterial Expression, Synthetic Biology ; pBb vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    PmutS-yfp
  • Promoter P-mutS

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGTACTTGCTTCATAAGCATCA
  • 3′ sequencing primer ACATGATACCGGAGTTAATCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Pconst-rfp
  • Promoter P-const

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGTCCCTCTCGATGGCTG
  • 3′ sequencing primer TTATCAAAAAGAGTATTGACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pconst-rfp + PmutS-yfp was a gift from Mary Dunlop (Addgene plasmid # 121444 ; http://n2t.net/addgene:121444 ; RRID:Addgene_121444)
  • For your References section:

    Heterogeneity in efflux pump expression predisposes antibiotic-resistant cells to mutation. El Meouche I, Dunlop MJ. Science. 2018 Nov 9;362(6415):686-690. doi: 10.1126/science.aar7981. 10.1126/science.aar7981 PubMed 30409883