PacrAB-acrAB-rfp + PmutS-mutS-yfp
(Plasmid
#121443)
-
Purposeplasmid expressing translational fusions of AcrAB and MutS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePacrAB-acrAB-rfp + PmutS-mutS-yfp in SC101 origin vector
-
Vector typeBacterial Expression, Synthetic Biology ; pBb vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePmutS-mutS-yfp
- Promoter PmutS
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGTACTTGCTTCATAAGCATCACGCA
- 3′ sequencing primer CACCAGGCTCTTCAAGCGATAAATCCA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePacrAB-acrAB-rfp
- Promoter PacrAB
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCCTGTCCTTTGTTACCGG
- 3′ sequencing primer ATGAACAAAAACAGAGGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PacrAB-acrAB-rfp + PmutS-mutS-yfp was a gift from Mary Dunlop (Addgene plasmid # 121443 ; http://n2t.net/addgene:121443 ; RRID:Addgene_121443) -
For your References section:
Heterogeneity in efflux pump expression predisposes antibiotic-resistant cells to mutation. El Meouche I, Dunlop MJ. Science. 2018 Nov 9;362(6415):686-690. doi: 10.1126/science.aar7981. 10.1126/science.aar7981 PubMed 30409883