HA-Foxo1ADA (pCMV5)
(Plasmid #12143)

• Depositing Lab: Domenico Accili
• Publication: Nakae et al J Clin Invest. 2001 Nov . 108(9):1359-67.

Backbone

• Vector backbone: pCMV5
• Backbone size w/o insert (bp): 4657
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Foxo1 ADA
• Alt name: Fkhr ADA
• Alt name: Foxo1
• Alt name: forkhead box O1
• Species: M. musculus (mouse)
• Insert Size (bp): 2100
• Mutation: Phosphorylation-deficient, also referred to as constitutivley active. Contians three point mutaitons: Thr24Ala, Ser253Asp, Ser316Ala*
• Entrez Gene: Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
• Promoter: CMV
• Tags / Fusion Proteins:
  • myc (N terminal on backbone)
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: hGH-pA-R (CCAGCTTGGTTCCCAATAGA)

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Also contains G282R, K219R, and L619P polymorphisms, which are not known to affect function.