pLenti-TagGFP2
(Plasmid #121426)

• Purpose: TAgGFP2 was amplified from pLenti-Origene-Nrf21 and inserted into XhoI and EcoRI digested pLenti-Origene-Nrf21.
• Depositing Labs: Ovijit Chaudhuri, Stanley Qi
• Publication: Lee et al Nat Commun. 2019 Apr 23;10(1):1848. doi: 10.1038/s41467-019-09755-0.

Backbone

• Vector backbone: pLenti-Origene
• Total vector size (bp): 6970
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: empty TagGFP2
• Promoter: CMV
• Tag / Fusion Protein:
  • TagGFP2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TGCAGGGGAAAGAATAGTAGAC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Antonia A. Dominguez and Lei S. Qi, Stanford University

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry