pSLQ1371-sgSTAT3-1
(Plasmid #121425)

• Purpose: sgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.
• Depositing Labs: Ovijit Chaudhuri, Stanley Qi
• Publication: Lee et al Nat Commun. 2019 Apr 23;10(1):1848. doi: 10.1038/s41467-019-09755-0.

Backbone

• Vector backbone: pSLQ1371
• Total vector size (bp): 8319
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgSTAT3-1
• Species: H. sapiens (human)
• Insert Size (bp): 20
• Promoter: mouse U6
• Tag / Fusion Protein:
  • mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstXI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GAGATCCAGTTTGGTTAGTACCGGG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Antonia A. Dominguez and Lei S. Qi, Stanford University
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry