Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lentiCRISPRv2_PROX1_1+3
(Plasmid #121176)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121176 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v2 (Plasmid #52961)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9-P2A-puro and U6 promoters driven expression of gRNAs
  • Species
    Streptococcus pyogenes
  • Tag / Fusion Protein
    • P2A-puro

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Modified version of lentiCRISPR v2 (Plasmid #52961) to incorporate the expression of two gRNAs from two independent U6 promoters.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA 1: GCTCAAGAATCCCGGGACCC
gRNA 3: CCTGAGAGCAAAGCGCGCCC

Used to KO PROX1 in Högström et al. 2018 (doi: 10.1158/0008-5472.CAN-18-0451.)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPRv2_PROX1_1+3 was a gift from Timo Otonkoski (Addgene plasmid # 121176 ; http://n2t.net/addgene:121176 ; RRID:Addgene_121176)