Skip to main content
Addgene

Geph UTR shRNA
(Plasmid #121070)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121070 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    mU6pro
  • Vector type
    RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPHN shRNA
  • gRNA/shRNA sequence
    GCCGUUGCAUAUGACAGGAUACAGU
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Gphn (a.k.a. Geph)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer unknown
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was originally cloned in Angel de Blas's lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

It targets gephyrin mRNA, nucleotides 2401-2425 located in the 3'-UTR of GenBank accession numbers NM_022865.3 and gi145553981.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Geph UTR shRNA was a gift from Angel de Blas (Addgene plasmid # 121070 ; http://n2t.net/addgene:121070 ; RRID:Addgene_121070)

  • For your References section:

    Gephyrin clustering is required for the stability of GABAergic synapses. Yu W, Jiang M, Miralles CP, Li RW, Chen G, de Blas AL. Mol Cell Neurosci. 2007 Dec;36(4):484-500. doi: 10.1016/j.mcn.2007.08.008. Epub 2007 Aug 23. 10.1016/j.mcn.2007.08.008 PubMed 17916433
Related items:
Commonly requested with: