Geph CR3m shRNA
(Plasmid #121069)

• Purpose: Negative control shRNA for plasmid 121068: shRNA targeting the coding region of the gephyrin mRNA
• Depositing Lab: Angel de Blas
• Publication: Yu et al Mol Cell Neurosci. 2007 Dec;36(4):484-500. doi: 10.1016/j.mcn.2007.08.008. Epub 2007 Aug 23.

Backbone

• Vector backbone: mU6pro
• Vector type: RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GPHN shRNA
• gRNA/shRNA sequence: GAGGAAGUGCAGGCAGUAUGAACUG
• Species: R. norvegicus (rat)
• Entrez Gene: Gphn (a.k.a. Geph)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: unknown

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Insert was originally cloned in Angel de Blas's lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

3-point mutations (negative control for shRNA2 targeting gephyrin mRNA, plasmid 121068).