pJW1586
(Plasmid #121057)

• Purpose: mKate2^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms.
• Depositing Lab: Jordan Ward
• Publication: Ashley et al Genetics. 2021 Mar 31;217(3). pii: 6104563. doi: 10.1093/genetics/iyab006.

Backbone

• Vector backbone: pUC19 (modified)
• Backbone size w/o insert (bp): 2600
• Total vector size (bp): 10500
• Modifications to backbone: Addition of ccdB markers to facilitate homology arm cloning
• Vector type: Worm Expression, Cre/Lox, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Turbo
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mKate2-T^SEC^AID*::3xFlag
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 6850
• Tags / Fusion Proteins:
  • C. elegans codon optimized mKate2
  • auxin-inducible degron (AID*)
  • 3xFLAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Forward (tgtaaaacgacggccagt)
• 3′ sequencing primer: M13 Reverse (caggaaacagctatgaccatg)

Resource Information

• Supplemental Documents:
  • pJW1586 (mKate2-SEC-AID-3xFLAG also with AID-spacer at end of FP).ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is derived from pDD285 (AddGene plasmid 66826)