C103m
(Plasmid #121007)

• Purpose: MoClo golden gate assembly CD part for mScarlet-I-LAA (fast-folding mScarlet variant, codon-optimized for E. col, with LAA degradation tag; see https://www.fpbase.org/protein/mscarlet-i/).
• Depositing Lab: Richard Murray
• Publication: CIDAR MoClo Extension (unpublished)

Backbone

• Vector backbone: DVA
• Backbone size w/o insert (bp): 2100
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mScarlet-I codon optimized with LAA tag
• Species: Synthetic
• Insert Size (bp): 746
• Tag / Fusion Protein:
  • LAA degradation tag for ssrA (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AAATAGGCGTATCACGAGGCA
• 3′ sequencing primer: TTACCGCCTTTGAGTGAGCTG

Resource Information

• Supplemental Documents:
  • C103m.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see Supplemental Documents for annotated Genbank file.