P35m
(Plasmid #120946)

• Purpose: MoClo golden gate assembly AB part for pLbda-CasRQi (strong lambda promoter with downstream dCas binding site for Qi-lab gRNA (UC16m); gRNA sequence taken from DOI: 10.1016/j.cell.2013.02.022).
• Depositing Lab: Richard Murray
• Publication: CIDAR MoClo Extension (unpublished)

Backbone

• Vector backbone: DVA
• Backbone size w/o insert (bp): 2100
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): KL740
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pLbda-CasRQi
• Species: Synthetic
• Insert Size (bp): 99

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AAATAGGCGTATCACGAGGCA
• 3′ sequencing primer: TTACCGCCTTTGAGTGAGCTG

Resource Information

• Supplemental Documents:
  • P35m.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Very strong promoter! To avoid mutations, grow this plasmid in KL740 E. coli, or another strain containing lambda cI. If in KL740, grow at 30degreesC. Please see Supplemental Documents for annotated Genbank file.