P18m
(Plasmid
#120941)
-
PurposeMoClo golden gate assembly AB part for T7 promoter (strong, T7 polymerase-dependent constitutive promoter; use with C95m). Please see Supplemental Documents for annotated Genbank file.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120941 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneDVA
- Backbone size w/o insert (bp) 2100
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT7
-
SpeciesSynthetic
-
Insert Size (bp)26
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATAGGCGTATCACGAGGCA
- 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P18m was a gift from Richard Murray (Addgene plasmid # 120941 ; http://n2t.net/addgene:120941 ; RRID:Addgene_120941)