-
Purposeconditionally knockdown Rab27a in mouse cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRab27a
-
gRNA/shRNA sequenceGCTTCTGTTCGACCTGACAAA
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001301230.1
-
Entrez GeneRab27a (a.k.a. 2210402C08Rik, 2410003M20Rik, 4933437C11Rik, ash)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-Tet-On-shRab27a was a gift from Mien-Chie Hung (Addgene plasmid # 120930 ; http://n2t.net/addgene:120930 ; RRID:Addgene_120930) -
For your References section:
Exosomal PD-L1 harbors active defense function to suppress T cell killing of breast cancer cells and promote tumor growth. Yang Y, Li CW, Chan LC, Wei Y, Hsu JM, Xia W, Cha JH, Hou J, Hsu JL, Sun L, Hung MC. Cell Res. 2018 Aug;28(8):862-864. doi: 10.1038/s41422-018-0060-4. Epub 2018 Jun 29. 10.1038/s41422-018-0060-4 PubMed 29959401