AAVS1-Puro-CAG-GCaMP6s
(Plasmid #120896)

• Purpose: Donor plasmid targeting human AAVS1 safe harbor locus to generate GCaMP6s gene knockin. Contains two homologous arms flanking T2A-Puro resistance gene and CAG-driven GCaMP6s gene.
• Depositing Lab: Xiaojun Lian
• Publication: Jiang et al iScience. 2018 Oct 12;9:27-35. doi: 10.1016/j.isci.2018.10.007.

Backbone

• Vector backbone: AAVS1-CAG-hrGFP
• Backbone manufacturer: Su-Chun Zhang
• Backbone size w/o insert (bp): 8085
• Total vector size (bp): 11644
• Modifications to backbone: replace hrGFP with GCaMP6s
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6s
• Species: Synthetic
• Insert Size (bp): 1353
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: pCAGGS-5 (GGTTCGGCTTCTGGCGTGTGACC)
• 3′ sequencing primer: Bglob-pA-R (TTTTGGCAGAGGGAAAAAGA)

Resource Information

• Supplemental Documents:
  • AAVS1-Puro-CAG-GCaMP6s.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry