pET28a-mH6-Cas12g1
(Plasmid #120879)

• Purpose: Expresses E. coli codon optimized Cas12g1 effector in the pET28a backbone.
• Depositing Lab: Arbor Biotechnologies
• Publication: Yan et al Science. 2019 Jan 4;363(6422):88-91. doi: 10.1126/science.aav7271. Epub 2018 Dec 6.

Backbone

• Vector backbone: pET-28a+
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5495
• Total vector size (bp): 7802
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Cas12g1
• Alt name: LbCas12g
• Species: Synthetic
• Insert Size (bp): 2307
• Promoter: lac
• Tag / Fusion Protein:
  • mH6 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • pet28a-mh6-cas12g1.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at . mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC