pET28a-mH6-Cas12c1
(Plasmid
#120872)
-
PurposeExpresses E. coli codon optimized Cas12c1 effector in the pET28a backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-28a+
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5355
- Total vector size (bp) 9267
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas12c1
-
SpeciesSynthetic
-
Insert Size (bp)3912
-
MutationWT
- Promoter lac
-
Tag
/ Fusion Protein
- mH6 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-mH6-Cas12c1 was a gift from Arbor Biotechnologies (Addgene plasmid # 120872 ; http://n2t.net/addgene:120872 ; RRID:Addgene_120872) -
For your References section:
Functionally diverse type V CRISPR-Cas systems. Yan WX, Hunnewell P, Alfonse LE, Carte JM, Keston-Smith E, Sothiselvam S, Garrity AJ, Chong S, Makarova KS, Koonin EV, Cheng DR, Scott DA. Science. 2019 Jan 4;363(6422):88-91. doi: 10.1126/science.aav7271. Epub 2018 Dec 6. 10.1126/science.aav7271 PubMed 30523077