Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FLAG-PPP2R5E siRNA-resistant
(Plasmid #120861)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120861 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    ThermoFIsher
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 6700
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PPP2R5E
  • Alt name
    B56 epsilon
  • Alt name
    B' epsilon
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1437
  • Mutation
    silent mutation at aa 282-284 in PPP2RE to generate siRNA-resistant RNA
  • Entrez Gene
    PPP2R5E (a.k.a. B56E, B56epsilon)
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer GAAAGTATTGATCCCTTTACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    openbiosystems

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-PPP2R5E siRNA-resistant was a gift from Emily Foley (Addgene plasmid # 120861 ; http://n2t.net/addgene:120861 ; RRID:Addgene_120861)
  • For your References section:

    The PP2A(B56) phosphatase promotes the association of Cdc20 with APC/C in mitosis. Lee SJ, Rodriguez-Bravo V, Kim H, Datta S, Foley EA. J Cell Sci. 2017 May 15;130(10):1760-1771. doi: 10.1242/jcs.201608. Epub 2017 Apr 12. 10.1242/jcs.201608 PubMed 28404789