W45A mutant of H3K9me3 biosensor
(Plasmid #120808)

• Purpose: FRET biosensor. Disrupting HP1 binding capability in H3K9me3 biosensor to abolish the detection capability
• Depositing Lab: Yingxiao Wang
• Publication: Peng et al Proc Natl Acad Sci U S A. 2018 Nov 26. pii: 1811818115. doi: 10.1073/pnas.1811818115.

Backbone

• Vector backbone: pCAGGS vector
• Backbone size w/o insert (bp): 4717
• Total vector size (bp): 7021
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Truncated YPet-HP1(W45A mutation)-EV linker-ECFP-mouse histone H3
• Species: M. musculus (mouse), D. melanogaster (fly), Synthetic
• Insert Size (bp): 2304
• Mutation: Tryptophan 45 is mutated to Alanine 45 on HP1 domain
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GCCTCTGCTAACCATGTTCATGCC
• 3′ sequencing primer: CAGATGCTCAAGGGGCTTCATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry