gamma2 CR3m shRNA
(Plasmid
#120795)
-
PurposeNegative control shRNA for plasmid 120794: shRNA targeting the coding region of the gamma2 mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemU6pro
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGABRG2 shRNA
-
gRNA/shRNA sequenceAGTGAAGCCTGGGTACAGTGAGAGC
-
SpeciesR. norvegicus (rat)
-
Entrez GeneGabrg2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert was originally cloned in Angel de Blas's lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
3-point mutations (negative control for shRNA2 targeting gamma2 mRNA, plasmid 120794).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gamma2 CR3m shRNA was a gift from Angel de Blas (Addgene plasmid # 120795 ; http://n2t.net/addgene:120795 ; RRID:Addgene_120795) -
For your References section:
Disruption of postsynaptic GABA receptor clusters leads to decreased GABAergic innervation of pyramidal neurons. Li RW, Yu W, Christie S, Miralles CP, Bai J, Loturco JJ, De Blas AL. J Neurochem. 2005 Nov;95(3):756-70. doi: 10.1111/j.1471-4159.2005.03426.x. 10.1111/j.1471-4159.2005.03426.x PubMed 16248887