pLEX-FKBP-BclXL-Blasticidin
(Plasmid #120718)

• Purpose: Expresses mitochondrial membrane-targeted recruiter protein in mammalian cells & for virus production
• Depositing Lab: Paul Khavari
• Publication: Kovalski et al Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001.

Backbone

• Vector backbone: pLEX
• Backbone manufacturer: Thermo Scientific
• Backbone size w/o insert (bp): 11000
• Total vector size (bp): 12000
• Modifications to backbone: Puromycin resistance cassette swapped for blasticidin resistance.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Bl2-like protein 1, isoform Bcl-X(L)
• Species: H. sapiens (human)
• Insert Size (bp): 1206
• Mutation: 33 c-terminal amino acids
• Promoter: CMV
• Tags / Fusion Proteins:
  • FKBP (N terminal on insert)
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CACCAAAATCAACGGGACTT
• 3′ sequencing primer: ATATAGACAAACGCACACCGGCCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: FKBP-mCherry-BclXL insert was cloned out of Addgene plasmid #72905.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry