pLEX-FKBP-Kras-Blasticidin
(Plasmid #120714)

• Purpose: Expresses membrane-targeted recruiter protein in mammalian cells & for virus production
• Depositing Lab: Paul Khavari
• Publication: Kovalski et al Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001.

Backbone

• Vector backbone: pLEX
• Backbone manufacturer: Thermo Scientific
• Backbone size w/o insert (bp): 11000
• Total vector size (bp): 12000
• Modifications to backbone: Puromycin resistance cassette swapped for blasticidin resistance.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: KRAS4B
• Species: H. sapiens (human)
• Insert Size (bp): 1202
• Mutation: amino acids 158-188
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Promoter: CMV
• Tags / Fusion Proteins:
  • FKBP (N terminal on insert)
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CACCAAAATCAACGGGACTT
• 3′ sequencing primer: ATATAGACAAACGCACACCGGCCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: FKBP-mCherry-KrasC30 insert was cloned out of Addgene plasmid #72900.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry