Skip to main content
Addgene

pLEX-FHH-Raf1RBD
(Plasmid #120707)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120707 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLEX
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 10778
  • Total vector size (bp) 11175
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Raf1 RBD
  • Insert Size (bp)
    447
  • Mutation
    Raf1 amino acids 1-149
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag-HA-6xHIS (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACCAAAATCAACGGGACTT
  • 3′ sequencing primer ATATAGACAAACGCACACCGGCCT
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    MGC Human RAF1 Sequence-Verified cDNA Clone ID: 3904404 (Dharmacon; Cat# MHS6278-202756888)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEX-FHH-Raf1RBD was a gift from Paul Khavari (Addgene plasmid # 120707 ; http://n2t.net/addgene:120707 ; RRID:Addgene_120707)

  • For your References section:

    The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2. Kovalski JR, Bhaduri A, Zehnder AM, Neela PH, Che Y, Wozniak GG, Khavari PA. Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001. 10.1016/j.molcel.2018.12.001 PubMed 30639242
Related items:
Commonly requested with: