-
Purpose(Empty Backbone) For cloning genes with an N-terminal TAP tag [Flag-HA-6xHIS]
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLEX
-
Backbone manufacturerThermo Scientific
- Backbone size (bp) 10778
-
Vector typeMammalian Expression, Lentiviral
- Promoter CMV
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- Flag-HA-6xHis (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CACCAAAATCAACGGGACTT
- 3′ sequencing primer ATATAGACAAACGCACACCGGCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX-FHH-Empty Vector-IRES-Puro was a gift from Paul Khavari (Addgene plasmid # 120568 ; http://n2t.net/addgene:120568 ; RRID:Addgene_120568) -
For your References section:
The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2. Kovalski JR, Bhaduri A, Zehnder AM, Neela PH, Che Y, Wozniak GG, Khavari PA. Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001. 10.1016/j.molcel.2018.12.001 PubMed 30639242