pLEX-uORF-HA-birA*-N-Ras(wildtype)-IRES-Puro
(Plasmid #120563)

• Purpose: Expresses HA-birA*-N-Ras wildtype fusion protein in mammalian cells & for virus production
• Depositing Lab: Paul Khavari
• Publication: Kovalski et al Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001.

Backbone

• Vector backbone: pLEX
• Backbone manufacturer: Thermo Scientific
• Backbone size w/o insert (bp): 10682
• Total vector size (bp): 12249
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NRAS
• Species: H. sapiens (human)
• Insert Size (bp): 1617
• Entrez Gene: NRAS (a.k.a. ALPS4, CMNS, KRAS, N-ras, NCMS, NRAS1, NS6)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA-birA* (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CACCAAAATCAACGGGACTT
• 3′ sequencing primer: ATATAGACAAACGCACACCGGCCT

Resource Information

• Supplemental Documents:
  • pLEX-uORF-HA-birA*-N-Ras(wildtype)-IRES-Puro.gbk
• A portion of this plasmid was derived from a plasmid made by: pCGN N-Ras WT (Addgene; Cat# 14723)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry