pAG71 BDNF 3'UTR mut
(Plasmid
#12054)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIS2
-
Backbone manufacturerpIS2 derived from pRL-SV40 (Promega)
- Backbone size w/o insert (bp) 3700
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBDNF 3'UTR mut
-
Alt nameBDNF
-
Alt namebrain-derived neurotrophic factor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1141
-
MutationMutations in microRNA recognition sites (seed matches): 3751-3756 and 3921-3926 and 4853-4858.
-
GenBank IDNM_170735
-
Entrez GeneBDNF (a.k.a. ANON2, BULN2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BDNF 3'UTR mutant in renilla luciferase reporter plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG71 BDNF 3'UTR mut was a gift from David Bartel (Addgene plasmid # 12054 ; http://n2t.net/addgene:12054 ; RRID:Addgene_12054) -
For your References section:
The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. Science. 2005 Dec 16. 310(5755):1817-21. 10.1126/science.1121158 PubMed 16308420