Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAG225 HIPK1 3'UTR mut
(Plasmid #12044)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12044 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIS2
  • Backbone manufacturer
    pIS2 derived from pRL-SV40 (Promega)
  • Backbone size w/o insert (bp) 3700
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HIPK1 3'UTR mut
  • Alt name
    HIPK1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    480
  • Mutation
    Mutations in microRNA recognition sites (seed matches).
  • GenBank ID
    NM_181358
  • Entrez Gene
    HIPK1 (a.k.a. Myak, Nbak2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HIPK1 3'UTR mutant in renilla luciferase reporter plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAG225 HIPK1 3'UTR mut was a gift from David Bartel (Addgene plasmid # 12044 ; http://n2t.net/addgene:12044 ; RRID:Addgene_12044)
  • For your References section:

    The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. Science. 2005 Dec 16. 310(5755):1817-21. 10.1126/science.1121158 PubMed 16308420