pCRIS
(Plasmid #120424)

• Purpose: This plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3, IS5, and IS150.
• Depositing Lab: Tamás Fehér
• Publication: Nyerges et al Synth Biol (Oxf). 2019;4(1):ysz008. doi: 10.1093/synbio/ysz008. Epub 2019 Mar 15.

Backbone

• Vector backbone: pCRISPathBrick
• Backbone size w/o insert (bp): 9326
• Total vector size (bp): 9590
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CRISPR spacers targeting IS1, IS5, IS3, IS150
• gRNA/shRNA sequence: ATGCTGCCAACTTACTGATTTAGTGTATGAgttttagagctatgctgttttgaatggtcccaaaacGGCTCCAGATGACA AACATGATCTCATATCgttttagagctatgctgttttgaatggtcccaaaacACGCGGCTAAGTGAGTAAACTCTCAGTC AGgttttagagctatgctgttttgaatggtcccaaaacGGGGCTATTCCATTTCATCGTCCAACAAAAgttttagagcta tgctgttttgaatggtcccaaaac
• Species: Escherichia coli
• Promoter: constitutive

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: n/a

Resource Information

• Supplemental Documents:
  • pCRIS.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/27/428029 for BioRxiv preprint.