pAAV-U6-Diras2_1-hSyn::mCherry.3xFLAG-WPRE
(Plasmid #120393)

• Purpose: pAAV plasmid expressing Diras2 shRNA1 under the U6 promoter and mCherry.3XFLAG under the hSyn promoter
• Depositing Lab: Florian Freudenberg
• Publication: Grunewald et al J Atten Disord. 2019 Jan 9:1087054718822129. doi: 10.1177/1087054718822129.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 5718
• Vector type: AAV, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Diras2 shRNA
• Species: M. musculus (mouse)
• Insert Size (bp): 53
• GenBank ID: NM_001024474
• Entrez Gene: Diras2 (a.k.a. 2900052J15Rik, AI414999)
• Promoter: U6
• Tags / Fusion Proteins:
  • mCherry.3XFLAG (C terminal on backbone)
  • mCherry.3XFLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspQI (destroyed during cloning)
• 3′ cloning site: BspQI (destroyed during cloning)
• 5′ sequencing primer: GCCAACTCCATCACTAGGGG
• 3′ sequencing primer: ATGCGCAATTTGGGGAATGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The original backbone was published in Candemir et al. Eur Neuropsychopharmacol. 2016 (PMID: 26861996)